Perspective of Covid 19 Hesistancy

Nnodim John Kennedy

x1. Latkin CA, Dayton L, Yi G, Konstantopoulos A, Boodram B (2021) Trust in a COVID-19 vaccine in the USA social-ecological perspective. Soc. Sci. Med 270: 113684.

x2. Dube E, Vivion M, MacDonald NE (2015) Vaccine hesitancy, vaccine refusal and the anti-vaccine movement: Influence, impact and implications. Expert Rev. Vaccines 14: 99-117.

x3. Trogen B, Caplan A (2021) Risk Compensation and COVID-19 Vaccines. Ann. Intern. Med. 2021.

x4. Wu Z, McGoogan JM (2020) Characteristics of and important lessons from the coronavirus disease 2019 (COVID-19) outbreak in China: summary of a report of 72 314 cases from the Chinese Center for Disease Control and Prevention. JAMA 323: 1239-42.

x5. Shen SC, Dubey V (2019) Addressing vaccine hesitancy: Clinical guidance for primary care physicians working with parents. Can. Fam. Physician 65: 175-81.

x6. Jarrett C, Wilson R, O’Leary M, Eckersberger E, Larson HJ (2015) SAGE Working Group on Vaccine Hesitancy Strategies for addressing vaccine hesitancy - A systematic review. Vaccine 33: 4180-90.

x7. Arede M, Bravo-Araya M, Bouchard E, Singh Gill G, Plajer V, et al. (2018) Combating Vaccine Hesitancy: Teaching the Next Generation to Navigate Through the Post Truth Era. Front. Public Health 6: 381.

x8. Lazarus JV, Ratzan SC, Palayew A, Gostin LO, Larson HJ, et al. (2021) A global survey of potential acceptance of a COVID-19 vaccine. Nat. Med 27: 225-8.

Department of Medical Laboratory Science, Imo State University, Owerri, Imo State, Nigeria

^*Corresponding author:
Nnodim John Kennedy, Department of Medical Laboratory Science, Imo State University, Owerri, Imo State, Nigeria, Tel: +2348181366290, Email: johnkennedy23@yahoo.com

Perspective of Covid 19 Hesistancy

Nnodim John Kennedy^*

Citation: Nnodim John Kennedy (2022) Perspective of Covid 19 Hesistancy. J Vaccine Res 1: 104

Copyright: © 2022 Nnodim John Kennedy. This is an open-access article distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited.

Introduction

Covid 19 vaccine hesitancy is when there is delay in acceptance or refusal of Covid 19 vaccine despite availability of the services. Indeed, it is caused by complex and context specific varying across time, place and vaccines. However, it is influenced by factors such as complacency, convenience, confidence and sociodemographic contexts [1].

Covid 19 vaccine hesitancy could be linked to misinformation and conspiracy theories which are oftentimes disseminated online, including through social media such as WhatsApp, Facebook etc. Also, structural factors such as health inequalities, socioeconomic disadvantages, systemic racism, and barriers to access are key drivers of low confidence in vaccines and poor uptake [2].

It has been noted that confidence in the role of vaccines has the strongest association with vaccine uptake; but, confidence in the necessity and value, safety, and effectiveness of vaccines fell in some countries recently [3]

The low confidence in covid-19 vaccines could be caused by misinformation, disinformation, rumors, and conspiracy theories, in particular through social media. Also, lack of effective public health messages or targeted campaigns as well as barriers to access, including vaccine delivery time, location, and cost related to socioeconomic inequalities and marginalization may be responsible [4]

The vaccine hesitancy is complex, and therefore no single intervention can address this entirely, especially in the context of covid-19 where evidence for effective strategies to address it is currently highly limited. [2]

Today, there is great concerns about long term effects, side effects, and unknown future effects of covid 19 on health [1]

Lack of trust in the manufacturing and country of production of vaccines, vaccine technology, the pharmaceutical industry, government, and public health bodies have worsened the issue of covid 19 vaccine hesistancy. The belief in conspiracy theories such as covid-19 not being real, or that vaccines modify DNA has really given boost to Covid 19 vaccine hesistancy [5]

The decision making around covid 19 vaccine hesistancy involves a complex mix of cultural, psychosocial, spiritual, political, and cognitive factors [6]

Therefore, more research should be done to expose the grey areas in covid 19 vaccine to make more acceptable in the society [7-8]

References

x1. Latkin CA, Dayton L, Yi G, Konstantopoulos A, Boodram B (2021) Trust in a COVID-19 vaccine in the USA social-ecological perspective. Soc. Sci. Med 270: 113684.

x2. Dube E, Vivion M, MacDonald NE (2015) Vaccine hesitancy, vaccine refusal and the anti-vaccine movement: Influence, impact and implications. Expert Rev. Vaccines 14: 99-117.

x3. Trogen B, Caplan A (2021) Risk Compensation and COVID-19 Vaccines. Ann. Intern. Med. 2021.

x5. Shen SC, Dubey V (2019) Addressing vaccine hesitancy: Clinical guidance for primary care physicians working with parents. Can. Fam. Physician 65: 175-81.

x6. Jarrett C, Wilson R, O’Leary M, Eckersberger E, Larson HJ (2015) SAGE Working Group on Vaccine Hesitancy Strategies for addressing vaccine hesitancy - A systematic review. Vaccine 33: 4180-90.

x8. Lazarus JV, Ratzan SC, Palayew A, Gostin LO, Larson HJ, et al. (2021) A global survey of potential acceptance of a COVID-19 vaccine. Nat. Med 27: 225-8.

1. Article title

2. Introduction

3. References

Figure 1: Images of electrophoresis gels showing: the integrity of the extracted genomic DNA. A 1 Kb DNA Ladder marker (Invitrogen, Carlsbad, USA) (A) was used and the absence of amplicons was verified using specific primers for BPV-2 (B), BPV-4 (C) and BPV-1 (D). The images show only the presence of amplicons consistent with the positive controls. Marker used 100 bp DNA Ladder (Invitrogen, Carlbad, USA) in figures B, C and D

Figure 2: Statistical graph comparing the score values of the treated samples in relation to the positive control, in which the C-, Saponins, DMSO and H groups showed significant differences with the comparative group, not showing a mutagenic character

Figure 3: Microscopic analysis of the Micronucleus Test in blood cells A) Lymphocytes without the presence of a micronucleus; B) Lymphocyte with micronucleus

Figure 4: Statistical graph comparing the score values of the treated samples in relation to the positive control, in which only the C- and DMSO groups showed significant differences with the comparative group

Figure 5: Comparative histogram of the percentages of micronuclei counted among the samples with the 8 different treatments in Vero cells

Figure 6: Statistical graph comparing the means with standard deviation of viable cells of the treated samples in relation to the negative control, in which only the H and L1 + H groups did not show significant differences with the comparative group

Figure 7: Dot plot graph of the data analyzed using the BD Accuri C6 software for Vero cells treated according to Table 3 based on the average percentage of live cells, using the two-way ANOVA test followed by the test Tukey post-hoc (P <0.05) using GraphPad Prism software version 5 (GraphPad Software, Inc.)

Figure 8: Statistical graph of the data analyzed using the BD Accuri C6 software for vero cells treated according to table 3 in comparison to cells without treatment (C-). Based on the average percentage of cells distributed in each phase of the cell cycle and standard deviation, the two-way ANOVA test was performed followed by the Bonferroni post-hoc test (p <0.05) using the Graphpad prism software version 5 (GrandPad Software , Inc.)

Figure 9: Chromatographic analysis of the sigma Standard saponin extract (A) and the Saponin extract under test (B), in a UFLC Shimatzu system, model Proeminence. 21 fractions were eluted, which were collected and selected 13 (indicated by arrow). The material was fractioned in a Jupiter C18 semi- preparative reverse phase column (250 mm x 10 mm, Phenomenex) with a linear gradient from 0 to 80% acetonitrile in acidified water for 60 minutes, in a flow of 2mL / min. Absorbance was monitored at 225 and 280 nm

Figure 10: Deconvolution of the spectra of the fractions of pattern nº05 and nº09. The images were obtained through analysis using the Mass Analyzer 1.03 software. Through the deconvolution of the ions (m / z), the molecular masses of 740.09 Da for fraction nº05 and 740.17 Da for fraction nº09 of the standard

Figure 11: Deconvolution of the spectra of the fractions of sample nº06 and nº 10. The images obtained through analysis by Mass Analyzer 1.03 software.
Through the deconvolution of the ions (m / z), the molecular masses of 740.15 Da for fraction No. 06 and 740.14 Da for fraction No. 10 of the standard

Primer	Sequence (5’-3’)	Gene target	Expected size of amplicon (pb)
BPV-2	GTTATACCACCCAAAGAAGACCCT CTGGTTGCAACAGCTCTCTTTCTC	L2	164
BPV-4	GCTGACCTTCCAGTCTTAAT CAGTTTCAATCTCCTCTTCA	E7	170
Degenerate Nucleotides: W - A ou T, Y – C ou T, M – C ou A, R – A ou G, K – T ou G, V – A, C ou G, H – A, C ou T, D – C, G ou T, I – A, C ou T. Table 1:Sequences of primers for diagnosis

	Specific Primers
	Time	Temp.
Start	3 min	94ºC
Denaturation	50 sec	94ºC
Ringing	1 min	60ºC
Extension	1 min	72ºC
Cycles	35
Final extension	5 min	72ºC
Table 2:PCR reaction parameters using the different pairs of primers

Abbreviations	Tested Drugs	Concentration
C-	-	-
C+	Ciclofosfamida (in PBS)	50ug/mL
L1	L1 of BPV-1 (in PBS)	1ug/mL
Al(OH)3	Aluminum Hydroxide	10uL/mL
L1+ Al(OH)3	L1 of BPV-1 Recombinant (in PBS)+ Aluminum Hydroxide	1ug/mL + 10uL/mL
Saponin	Aqueous Extract of Agave sisalana (in PBS and DMSO 2% )	50ug/mL
L1+Saponin	L1 of BPV-1 Recombinant (in PBS)+ Aqueous Extract of Agave sisalana (in PBS and DMSO 2%)	1ug/mL +50gL/mL
DMSO	DMSO 2%+PBS	10uL/mL
Table 3:Drugs Tested and Work Concentrations

Samples	ng/µL	R (260/230)	R (260/280)
1	17	1, 07	1, 03
2	27	0, 93	1, 08
3	27	0, 93	1, 08
4	65	1, 00	1, 57
5	70	0, 82	1, 39
6	65	1, 06	1, 58
7	43	0, 83	1, 70
8	37	1, 32	1, 26
9	80	1, 90	1, 64
10	26	3, 15	1, 49
Table 4:Spectrophotometer determination of the DNA concentration of the collected blood samples and the different ratios at different wavelength.

Sample	Class 0	Class 1	Class 2	Score
Negative control (blood cells w ith no substance	537	126	131	398
Positive control 50µg/m L cycl	25	278	500	1278
Experim ental group 1 (1 µg / ml of recL1)	414	173	213	599
Experim ental group 2 (1 µg / m L of rec L1 + 50ug / m L of Saponins	369	237	194	625
Experim ental group 3 (10uL / m L of Al(OH)3	505	167	129	425
Experim ental group 4 (50ug / m L Saponins	513	128	159	446
Experim ental group 5 (1 µg / ml of rec L1 + 10uL / ml of Al(OH)3	490	32	278	588
Contol Group (DMSO + PBS (2%)	512	178	110	398
Number of nucleoids observed by class (0 - no damage, 1 - intermediate damage and 2 - maximum damage), and the respective score value that shows the damage index - obtained from the sum of the product of the number of nucleoids (N) by the respective value of class (C), according to the formula: Σ= (NxC0) + (NxC1) + (NxC2). Total of 8 samples. Cycl= cyclophosphamide. Rec= recombinante Table 5:: Results and scores obtained in the analysis of mutagenic potential by comet assay from 8 sample.

	Table 6:Dunn's post-hoc test statistical values obtained using the GraphPad Prism software version 5

Sample	Class 0	Class 1	Class 2	Score
Negative control Only Vero cells	140	05	03	13
Positive control (50 µg / m L cycle	17	40	93	226
Experimental group 1 1 µg / m L of rec L1	61	37	53	141
Experimental group 2 (1 µg / ml of rec L1 + 50ug / ml of Saponins)	63	29	58	145
Experimental group 3 (10uL / m L of Al(OH)3	61	33	53	138
Experimental group 4 (50ug / m L Saponins)	33	54	63	180
Experimental group 5 (1 µg / ml of rec L1 + 10uL / ml of Al(OH)3	60	41	59	159
Control Group DMSO + PBS (2%)	112	21	19	59
Table 7:Number of nucleoids observed by class (0 - no damage, 1 - intermediate damage and 2 - maximum damage), and the respective score value that shows the damage index - obtained from the sum of the product of the number of nucleoids (N) by the respective value of class (C), according to the formula: Σ = (NxC0) + (NxC1) + (NxC2)

	Table 8:Drugs Tested and Work Concentrations

Samples	Nº Micronuclei	MNr0
C+	691	0, 691
C-	77	0, 077
Al(OH)3	148	0, 148
L1+ Al(OH)3	176	0, 176
L1	106	0, 106
Saponin	226	0, 226
L1+Saponin	266	0, 266
DMSO	113	0, 113
Table 9:Number of micronuclei found per slide and calculated frequency


Sample	Class 0	Class 1	Class 2	Score
Negative Control	338	26	18	64
Positive Control 50 µg/mL de cycl	69	40	191	422
Control Group DMSO + PBS 2%	150	111	39	189
Experimental Group Standard (Sample 1)	123	48	119	286
Experimental Group Standard (Sample 2)	143	76	82	240
Experimental Group Standard (Sample 8)	180	102	19	140
Experimental Group Standard (Sample 9)	204	21	74	214
Experimental Group Standard (Sample 10)	85	20	60	140
Experimental Group Standard Sample 5	271	72	57	286
Experimental Group Standard Sample 4	141	98	59	216
Experimental Group AEHAS Sample 2	91	87	122	331
Experimental Group AEHAS (Sample 6)	157	28	115	258
Experimental Group AEHAS (Sample 7)	77	88	135	358
Experimental Group AEHAS (Sample 8)	65	99	133	365
Experimental Group AEHAS (Sample 10)	121	50	130	310
Experimental Group AEHAS (Sample 11)	199	29	72	173
Table 10:Number of nucleoids observed by class (0 - no damage, 1 - intermediate damage and 2 - maximum damage), and the respective score value that shows the damage index - obtained from the sum of the product of the number of nucleoids (N) by the respective value of class (C), according to the formula: Σ = (NxC0) + (NxC1) + (NxC2). From 3 samples

Negative Control	Score: 64
Positive Control	Score: 422
DMSO	Score: 189

Standard nº Pico	Retencion time (min)	score
1	28,13-30,54	286
2	30,54-31,66	240
4	32,64-34,13	216
5	34,13-35,22	286
8	38,28-39,28	140
9	39,28-40,84	214
10	40,84-42,57	140

EHAS nº Pico	Retencion time (min)	Score
2	30,17-32,29	331
6	34,90-35,11	258
7	35,11-37,14	358
8	37,14-38,58	365
10	39,47-41,42	310
11	41,42-42,04	173
Table 11:Comparison between standard and sample in relation to retention time and genotoxic activity scores of the comet assay

Journal of Vaccine Research

Perspective of Covid 19 Hesistancy

Table and Figures